Skip to main content

Table 2 Primer sequences used to amplify fragments of the rRNA genes and internal transcribed spacers

From: Identification and epidemiological analysis of Perostrongylus falciformis infestation in Irish badgers

Locus (size) Primer Sequence Ref
18S (700 bp) External Fw: 5′ AAAGATTAAGCCATGCA 3′
Rev.: 5’GCAGGTTCACCTACAGAT 3’
[22]
Nested Fw: 5’ CGGCTCATTAGAGCAGATGTC 3′
Rev.: 5′ TCCTCTTTTATTATTCCATGATCG 3’
This study
ITS2 (548 bp) External Fw: 5’ TTTGAACGCATAGCGTCGT 3′
Rev.: 5′ TTAGTTTCTTTTCCTCCGCT 3’
This study [23]
Hemi-nested Fw: 5’ ACGTCTGGTTCAGGGTTGTT 3′
Rev.: 5′ TTAGTTTCTTTTCCTCCGCT 3’
[23]
Connecting fragment (1953 bp) External Fw: 5’ GCCTTTGGCGTTAATCACTG 3′
Rev.: 5′ TCACGATCATCAATCCATCG 3’
This study
Nested Fw: 5’ AGAACAAGCGTTTGCTTGAA3′
Rev.: 5′ GTATGACCAACAGCCGAACA3’
This study