Skip to main content

Table 1 Nucleotide sequences and position within vp60 gene for RHDV2 RT-qPCR primers and probe

From: First detected case of rabbit Haemorrhagic disease virus 2 (RHDV2) in the Irish hare (Lepus timidus hibernicus)

Oligonucleotide Sequence (5′-3′) Position in vp60 gene
RHDV2-F TGGAACTTGGCTTGAGTGTTGA 1571–1592
RHDV2-R ACAAGCGTGCTTGTGGACGG 1678–1697
RGDV2 probe FAM-TGTCAGAACTTGTTGACATCCGCCC-BHQ1 1664–1640